by W. Mark Whitten, Florida Museum of Natural History, Gainesville FL and Colette C. Jacono, United States Geological Survey, Gainesville FL

Abstract

Marsilea ferns (water clover) are potentially invasive aquatic and wetland plants that are difficult to identify to species because of subtle diagnostic characters, sterile specimens, and unresolved taxonomic problems. We utilized DNA sequencing of several plastid regions to attempt to “fingerprint” Marsilea specimens from the southeastern U.S. to provide more accurate identifications. Currently, seven species are recognized from the eastern U.S., 6 of which have been found in Florida. Our data show that Florida specimens previously identified as M. oligospora (Jacono and Johnson 2006) are not true M. oligospora (native to the western U.S.), and instead may represent either an unknown introduced species or an undescribed native species.

Molecular data conflict with the morphological characters for distinguishing M. vestita, M. macropoda, and M. nashii. The molecular data reveal two clades within this species complex: 1. A western U.S/Mexican clade; and 2. an eastern U.S./coastal plain clade. This DNA/morphology discordance suggests that these taxa may have hybridized extensively or may represent only one variable species; either case warrants reexamination of the species level-taxonomy of the group. DNA data clearly distinguish all other species of introduced Marsilea, and DNA sequencing is valuable as a tool for identification of sterile Marsilea specimens.

Introduction

Marsilea (Water-Clover) is a genus of aquatic ferns that is increasingly being found as invasive in Florida and the Southeast. Marsilea (ca. 50 spp.) occur worldwide as two ecological types 1) true aquatic species with glabrous leaves that inhabit permanent water bodies and 2) semi-aquatic species with hairy leaves that prefer fluctuating wetland habitats and prevail through seasonal extremes in wet and dry periods. Florida’s lakes and wetlands provide habitat for both types and currently host at least six species of both ecological types, all of which have been hypothesized as introduced.

The Water-Clovers bear few dependable morphological characters on which to base traditional identification. Morphological plasticity is widespread, and sporocarps, an important identification feature, are commonly absent in field populations. Because identification of Marsileabased upon morphology is so problematic, aquatic plant managers need more reliable tools for identification. Without objective methods of identification, managers cannot make decisions about the probable identity and origin of introduced species and how to manage populations. In this study, we use DNA sequences of four plastid regions (rbcL, rps4, the rps4-trnS spacer, and the trnL-F spacer) to aid in identification of Marsilea specimens. The recent molecular phylogeny of Marsilea (Nagalingum et al., 2007) provides a phylogenetic framework for comparison of sequences in GenBank with those from additional specimens.

Several populations of Marsilea in Florida (far from natural, western U.S. distributions) have uncertain identities. Of primary interest are historical specimens, collected in the early 1890s, the identification of which has vacillated from M. vestita, an introduction from the western U.S. (Ward and Hall 1976) to M. ancylopoda, a rare and potentially extinct native species (FNA 1993). Plants in recently reported populations in three central Florida counties appearing identical to plants from the historic sites were identified as M. oligospora, a semi-aquatic North American species endemic to the northern fringe of the Great Basin (Jacono and Johnson 2006). Nevertheless, variation was noted between the Florida and the Great Basin material and it was difficult for the authors to speculate how a geographically restricted plant with no known economic value may have become established in central Florida over 100 years ago.

At the same time, invasive plant managers are interested in initiating herbicide practices on pest populations of Marsilea. One site of particular concern is Emeralda Marsh, a 1,500 acre restoration unit bordering Lake Griffin, Lake County, FL where M. oligospora appears to be increasing in wetlands where the naturally fluctuating hydrologic regime is being restored. Molecular data may provide a more confident determination of these specimens and help to resolve whether these populations are introduced weeds to be targeted for herbicide treatment or if they are a native component of natural wetlands.

Our specific objective is to provide molecular evidence to support or refute morphological identification and region of origin of the central Florida populations. Such evidence will provide a more sound basis for future pest plant listing and for responsible management practices. However, the laboratory procedures to be developed are a modest investment with wider application than identification of a single species. The method will serve as a screening protocol for well established, new and potentially invasive species of this difficult and typically sterile genus. In this project we surveyed all known populations of Marsilea within Florida using several molecular markers and compared them to all U.S. and Caribbean species, as well as Marsilea species common in the aquatic plant trade that are becoming established in the Southeast. These data will provide a baseline for evaluating the identity and nativity of species in Florida and for distinguishing future introductions of Marsilea.

Methods

Appendix 1 presents a list of voucher specimens sampled. Samples were taken from herbarium specimens (with permission) from various herbaria. Because Florida collections of M. oligospora were hypothesized to be introductions from the western US (Jacono and Johnson 2006), we included specimens from several western herbaria (from the vicinity of the type locality). Leaf samples (ca. 25 mm2) were ground using a tissue mill and extracted using a modified version of the 2x CTAB procedure of Doyle and Doyle (1987) with exclusion of beta-mercaptoethanol and inclusion of 5 units of proteinase K to improve yield and quality of DNA. Primers for rbcL were designed to allow amplification and sequencing in two overlapping pieces, facilitating amplification from degraded total DNAs. Primers for rbcL are: rbcL F ATGTCACCACAAACAGAGACTAAAGC; rbcL intF TGAGAACGTAAACTCCCAACCATTCA; rbcL intR CTGTCTATCGATAACAGCATGCAT; and rbcL R GCAGCAGCTAGTTCCGGGCTCCA. The rps4 exon and the adjacent rps4-trnS spacer were amplified in one piece using the primers rps4F ATGTCCCGTTATCGAGGACCT and rps4R TACCGAGGGTTCGAATC. Primers for the trnL-F spacer (primers E&F) were those of Nagalingum et al. (2007). All amplifications utilized Sigma Jumpstart Taq polymerase and reagents (Sigma-Aldrich, Inc.) in 25 μl reactions with 3.0 mM MgCl2. Thermocycler conditions were: 94 C for 3 minutes followed by 37 cycles of 94 C for 30 s, 56 C for 30 s, 72 C for 2 min, with a final extension of 3 min at 72 C. PCR products were sequenced in both directions, using the Big Dye Terminator reagents on an 3130 automated sequencer following manufacturer’s protocols (Applied Biosystems, Inc.). Electropherograms were edited and assembled using Sequencher 4.8 (Genecodes Inc., Ann Arbor, Michigan, USA), and the resulting sequences were aligned manually. All sequences will be deposited in GenBank prior to publication. Analyses were performed using PAUP* version 4.0 b10 (Swofford, 2003) with Fitch parsimony (equal weights, unordered characters, ACCTRAN optimization and gaps treated as missing data. Heuristic searches consisted of 1000 random taxon addition replicates of subtree-pruning-regrafting (SPR) and keeping multiple trees (MULTREES) with the number of trees limited to 10 per replicate to minimize extensive swapping on islands with many suboptimal trees.

Results and Discussion

Figures 1-3 presents a randomly chosen single most parsimonious tree. The tree combines data in GenBank from the world wide taxonomic sampling of Nagalingum et al. (2007) with data generated from this study (Appendix 1). Individuals noted in full Latin binomial are from GenBank data. Individuals noted by “M.” followed by a species name and three digit number and locality, usually a state and county, are primarily U.S. collections sampled by us in this study.

The Florida collections of Marsilea fall into five distinct clades within the tree; these clades are highlighted in gray and labeled Clades A-E.

The DNA data revealed that numerous specimens sampled in this study (especially sterile ones) were misdetermined. DNA analysis was especially effective in clarifying the identification of sterile specimens of both North American and introduced origin and was equally effective with aquatic and semiaquatic ecotypes.

Little or no genetic variation among geographically distant introductions of the same species (eg. M. minuta, M. hirsuta) suggests a wide reaching water garden industry as the source of North American material.

M. mutica (clade A; Figure 1) is clearly distinct from all other taxa in terms of DNA distance. This parallels its morphology which is unique from all other taxa for its two-toned leaflets and petioles inflated at the apex to function as air bladders for floating leaves. Indigenous to Australia and New Caledonia, M. mutica may be the most popular species in the water garden trade. The SE US specimens plus one from Oklahoma form a clade distinct from specimens from Arizona and Virginia. This is suggestive of at least two distinct geographic origins for material introduced into the US.

Clade B (Figure 2) includes M. hirsuta, an Australian species introduced into Florida. Three Australian hairy leaved species (M. drummondii, M. angustifolia and M. hirsuta) form a clade distinct from the Australian glabrous leaved species, M. mutica. DNA data fail to distinguish M. hirsutafrom M. angustifolia. Morphologically, M. angustifolia differs from M. hirsuta in having smaller and more elongated leaves and smaller sporocarps (Aston 1973). These characters, however, are typically considered insufficient for species distinction within the genus Marsilea (Launert 1968). Our DNA data suggests that the taxonomic boundaries of these two species should be reexamined.

Clade C (Figure 2) consists of M. minuta (plus M. crenata, M. fadeniana). Samples from introductions in the southeastern U.S. appear more closely related to M. minuta from India, and to M. crenata, from Thailand and Indonesia than to M. minuta from Africa. A population of M. minuta introduced to Trinidad since at least 1982 is discrete from the southeast material and more closely related to M. minuta and M. fadeniana from Africa. As presently circumscribed, M. minuta is a geographically widespread species that needs further taxonomic clarification. Although not tested in this study, M. crenata, which has been reported as introduced to Hawaii is probably the same entity as M. minuta in the SE US. Johnson (1986) suggested that M. quadrifolia, long established in the northeastern U.S., may be close to M. minuta, but, based on the one specimen from Japan sampled in this study, this would not be the case. M. quadrifolia is the most temperate of the Marsilea species. Generally, introductions of M. quadrifolia are from earlier dates and are believed to have originated from Europe. Paradoxically, in Europe it is now a Red Data species, listed for its rarity and vulnerability to extinction.

Clade D (Figure 2) includes Florida specimens previously determined as M. oligospora by Jacono (thought to represent an introduction from the western US), but DNA data show that these specimens do not match any material tested or in GenBank. They are clearly distinct from specimens of “true” M. oligospora (Figure 3) from the western US (close to the type locality). The DNA data demonstrates that it is a distinct species, yet related to M. ancylopoda, a widely distributed neotropical species with which it was earlier misidentified (FNA 1993). The geographic range of this M. aff. oligospora plus the existence of Florida collections from the 1890s suggests an alternative hypothesis: that it may be a native species. Although the very recent expansion of the species at artificial and disturbed habitats seems to dispute this assumption, only greater sampling of species in the Caribbean and tropical Americas might reveal the true identity of M. aff. oligospora in Florida.

Clade E (Figure 3) consists exclusively of plants from the U.S. Gulf Coast and Florida, and includes specimens determined as either M. vestita, M. macropoda, or M. nashii (from GenBank). Although well accepted as distinct North American species, the morphological distinctions separating vestita and macropoda clearly do not agree with the molecular data presented here. The correct name for plants in this clade (probably M. macropoda or M. nashii) is yet to be determined, and will require comparison of sequence data with specimens from the type localities of these two species. Comparison with specimens noted earlier as putative hybrids between M. vestita and macropoda in Texas (Johnson 1986) should also prove informative. The demarcation of specimens into Clade E introduces the scenario that plants previously labeled vestita and macropoda and considered western NA introductions into Florida, may in fact represent an independent entity (or hybrid) that could be native in Florida. If this were the case, it may serve as indirect support for the Clade D entity (M. aff. oligospora) occurring as native to Florida.

Clade F (Figure 3) consists of specimens of M. vestita and M. oligospora from the western US and Mexico, and suggests that species boundaries and taxonomy of these taxa need to be reevaluated. The Hawaiian species M. villosa and a specimen determined as M. fourneiri also fall in Clade F. Clearly, the taxonomic relationships of M. vestita, its subspecies, and related species need to be reexamined. One possible explanation for the geographic distinction between clades E and F is that these species have hybridized (resulting in a single chloroplast type because of uniparental inheritance of chloroplasts); this hypothesis could be evaluated by sequencing of a suitable nuclear marker that is biparentally inherited. However, we know of no experimental or molecular evidence that Marsileas do hybridize in nature.

Conclusions/Recommendations

In light of the difficulties inherent to morphological identification of Marsilea, resource managers can opt for DNA analysis as a reliable tool in species identification. DNA analysis effectively determined sterile specimens of North American and introduced species at a minimal cost per sample. Results from DNA analysis also revealed a low level of genetic diversity among collections of geographically distant introductions of the same species, which indicates a wide reaching industry as a source of the eastern hemisphere species M. minuta, M. hirsuta, and M. mutica.

DNA results further indicate that Florida M. aff. oligospora should not be regarded as an introduced species nor targeted for eradication until more is known about its identity. If the entity represents an undescribed native species, its increase at restoration marshes could be a sign of the return of more natural hydroperiods and ecological dynamics.

Discrepancies demonstrated by DNA analysis in the taxonomic relationships among specimens labeled M. vestita or M. macropoda has in the past been addressed by designation of morphological subspecies. In light of the geographical patterns found in our study, reexamination of this species group may reveal that a hybrid of the two, or a third species, could be native in Florida. If this were the case, it may further support the nativity of M. aff. oligospora in that state.

Literature Cited


Figure 1. Base of single most parsimonious tree for combined molecular data set.

Figure 1. Base of single most parsimonious tree for combined molecular data set.

 


Figure 2. Mid-portion of single most parsimonious tree for combined molecular data set.

Figure 2. Mid-portion of single most parsimonious tree for combined molecular data set.

 


Figure 3. Terminal clades of single most parsimonious tree for combined molecular data set

Figure 3. Terminal clades of single most parsimonious tree for combined molecular data set.

 


Appendix 1. Specimens sampled for DNA analysis in this study.

DNA numbers (column 1) correspond to three-digit numbers following taxon names in figures 1-3. Some specimens failed to amplify or sequence cleanly, and are not represented in the tree.

DNA numberTaxonCollectorHerbariumHerb acc .LocalityLocality detailmo-day-yr
5Marsilea ancylopodaLott 3321FLAS184721Mexico: Jalisco"Mpio. La Huerta: Las Alamandas, ca. 26 km NW of Estacion de Biologia Chamela on the Puerto Vallarta-Barra de Navidad (Mex. 200) hwy, and 3 km W of the village of Quemaro."1/16/91
6Marsilea hirsutaBeckner 2619FLASP8932FL: Pinellas"St. Petersburg, 46th St. and Fairfield Ave. S."8/13/83
7Marsilea macropodaWard 7623FLASP7699TX: San Patricio"9 mi NE of Sinton, near west end of Welder Wildlife Refuge."5/1/71
8Marsilea hirsutaJacono 257FLAS219917FL: Hillsborough"Northwest Mitigation Bank, Area C, off S. Mobley Rd, ca. 3 mi. SW of Citrus Park."4/22/01
9Marsilea hirsutaJacono 235FLAS219921FL : Pinellas"St. Petersburg, 46th St. and Fairfield Ave. S."3/31/01
10Marsilea macropodaBurkhalter 8846FLASP8925AL: MobileMobile; SE corner of Conception St. and Texas St.6/11/83
11Marsilea macropodaBurkhalter 5672FLASP8409AL: MobileMobile; SE corner of Church Street and Washington Ave.12/20/77
12Marsilea macropodaMcAlpin s.n.FLASP9864FL: Sarasota"Banks of drainage ditch along 51 Street, just east of Rt. 301."6/15/87
13Marsilea ancylopodaE. Lott 3321 dupe of 005FLAS184721Mexico: Jalisco"Mpio. La Huerta: Las Alamandas, ca. 26 km NW of Estacion de Biologia Chamela on the Puerto Vallarta-Barra de Navidad (Mex. 200) hwy, and 3 km W of the village of Quemaro."1/16/91
14Marsilea quadrifoliaJ. Allison 8001FLAS180750GA: Cobb Co."Ca. 0.7 mil WNW of Austell, W of Thornton Rd. and N of Garrett Rd.; Powder Springs Creek, near mouth confluence with Sweetwater Creek."9/18/93
15Marsilea minutaJ. Germann s.n.FLAS219925GA: McDuffie Co."Thompson, pond near."6/1/00
16Marsilea minutaJacono 394FLAS219922FL: Escambia"SW of Pensacola, N of Bayou Grande, Grundy St. and Lowndes Ave., NW side of intersection."2/28/02
17Marsilea minutaBurkhalter 13304FLAS179393FL: EscambiaNear Pensacola; NW corner of Lownde Ave. and Grundy St.6/19/92
18Marsilea minutaJacono 498FLAS219924FL: St. Lucie"Port St. Lucie, cultivated from material in canal."3/13/02
19Marsilea minutaJacono 512FLAS219923FL: SarasotaCultivated material originally from Marie Selby Botanical Garden.11/1/02
20Marsilea muticaJacono 503FLAS219936OK: Hughes"Cultivated from Holdenville, Stroup Park pond."10/1/01
21Marsilea muticaJacono 362FLAS219931GA: Dekalb"Davidson-Arabia Mountain Nature Preserve, lake off Rockland Rd."11/5/01
22Marsilea muticaCooper s.n.FLAS219932GA: Fulton"Palmetto; farm pond off Hutchinson Ferry Rd., ca. 4 mi from Hwy 29."10/24/01
23Marsilea muticaJacono 361FLAS219933GA: SpaldingShoal Creek subdivision Lake.11/5/01
24Marsilea muticaKirk s.n.FLAS219934MS: Madison"Lake Lorman, SW of Hwy 463."12/11/01
25Marsilea muticaDavis 1208FLAS215625FL: AlachuaGainesville; Kanapaha Botanical Gardens.4/2/05
26Marsilea muticaRodgers s.n.FLAS207131FL: Hillsborough"Tampa: Lake Magdalene, N of Fletcher Ave., E of Dale Mabry."7/2/02
27Marsilea muticaGreene s.n.FLAS219928AL: Marion"Hamilton, farm pond, S of John Craft Hwy, N of CR90."8/13/01
28Marsilea muticaJacono 502FLAS219930AL: Marion"Cultivated from Hamilton farm pond, S of John Craft Hwq, N of CR 90."11/19/02
29Marsilea oligosporaAnderson 1299FLASP8835UT: Cache"Dry Lake, 4 air miles NE of Brigham City."7/9/58
30Marsilea oligosporaJacono 508FLAS219938FL: Lake"Orange Bend, E side of road intersecting N of E Treasure Island Rd."12/8/02
31Marsilea oligosporaJacono 510FLAS219940FL: Lake"Emeralda Marsh, Treasure Island Entrance, St. Johns River Water Management Area."12/8/02
32Marsilea oligosporaJacono 511FLAS219941FL: Lake"Emeralda Marsh, W of Hwy 452; diked impoundment of Lake Griffin."12/8/02
33Marsilea oligosporaJacono 571FLAS219942FL: LakeOrange Bend. E side of road intersecting N of E Treasure Island Rd.5/1/04
34Marsilea oligosporaJacono 572FLAS219943FL: Lake"Emeralda Marsh, W of Hwy 452 Treasure Island Entrance of St. Johns Water Management District lands."5/1/04
35Marsilea oligosporaBrinson s.n.FLASP9670FL: Seminole"Roadsid ditch to Soldier's Creek, 2.5 miles west of Lake Jessup, west of SR 17/92"4/16/86
36Marsilea oligosporaJacono 177FLAS219944FL: Seminole"Soldier Creek, W side Hwy 17/92, approx. 6 air miles S of Sanford and 1.75 air miles W of Lake Jessup, just S of sign to ""Big Tree Park""."10/28/00
37Marsilea oligosporaMeisenburg s.n.FLAS219414FL: Volusia"Ormond Beach, 3 Wild Cat Lane, retention pond mitigation area."7/5/06
38Marsilea vestitaRaymond & Painter 81FLASP8220LA: CaldwellImmediately off US 165 at Riverton.7/16/74
39Marsilea vestita"Thomas 114,754"FLAS171536LA: CaldwellWest bank of Ouachita River at Columbia Recreation Area west of US 165 at Columbia.11/21/89
40Marsilea vestitaBrodie s.n.FLAS219946FL: Collier"Immokalee, 618 9th St. S, E side of ditch."1/15/03
41Marsilea vestitaJacono 619FLAS219948FL: Collier"Cutivated in Gainesville from Immokalee, 618 9th St. S, E side of ditch."5/12/03
42Marsilea vestitaAnderson 7356FLASP9104FL: Franklin"Apalachicola, Ave. K near 9th Street."6/19/84
43Marsilea vestitaAnderson 7625FLASP9105FL: Franklin"Apalachicola, West side of N. Market Street (just N of Avenue I)"9/20/84
44Marsilea vestitaJacono 183FLAS219949FL: Franklin"Apalachicola, W of N Market St., N of Ave. F, S of Dr. Martin Luther King Jr. Ave."11/18/00
45Marsilea vestitaJacono 504FLAS219950FL: Franklin"Cultivated from Apalachicola, W of N Market St., N of Ave. F, S of Dr. Martin Luther King Jr. Ave."4/18/01
46Marsilea vestitaHall 414FLASP7953FL: HillsboroughOriginally brought from New Orleans; weed in flower bed at 1407 W. College Ave. in Ruskin.9/25/75
47Marsilea vestitaD. Thomas & E. Sundell 167474TENNAR: LincolnHuff Island Park along the Arkansas River at Joe Hardin Lock and Dam at the edn of Ark. 111 north of Grady; sect. 349/15/00
48Marsilea vestitaD. Thomas 114172TENNLA: CaldwellOachita River east of Copenhagen and La. 849 and south of Columbia; along sandbars and riverbank.10/31/89
49Marsilea vestitaD. Thomas & C. M. AllenTENNLA: St. JamesBeside La.44 and the Miss. River Levee at Dravco Materials Sunshine Yard about 2.1 miles North of Convent5/22/90
50Marsilea vestitaJ. Taylor 29759TENNOK: JohnstonHeadwaters area on Tishomingo National Wildlife Refuge8/28/80
51Marsilea macropodaG. Landry & S. Holder 7832TENNLA: OrleansNew Orleans; Abandoned lot at corner of Bienville and N. Salcedo Street3/15/81
52Marsilea minutaJ.T. Beck 3867TENNTN: Hamilton"Chattanooga: Lake Junior, near intersection of Hwy 153 and Amnicola Hwy Pond margins"10/18/00
53Marsilea macropodaK. Bradley 1858USF233213FL: Collier"Immokalee: At west end of 9th Street, west of US 29"7/4/98
54Marsilea macropodaB. McAlpin snUSF192158FL: Sarasota"Drainage ditch along 51st Street, just east of Rt. 301"6/15/87
55Marsilea macropodaB. McAlpin snUSF233128FL: Collier"Immokalee: At west end of 9th Street, west of US 29."4/9/99
56Marsilea vestitaA. Gholson et al. 11253USF198702FL: Franklin"Appalachicola: West side Market Street, 0.2 mi north from junction with Avenue F"4/5/85
57Marsilea minutaJ. Burkhalter 13304USF206485FL: EscambiaNear Pensacola; NW corner of Lownde Ave. and Grundy St.6/19/92
58Marsilea minutaJacono 667USF242904FL: BrevardSouth Central Wastewater Treatment Plant; cult. In Gainesville FL6/9/06
59Marsilea hirsutaJ. Beckner 2619USF171665FL: Pinellas"St. Petersburg, 46th St. and Fairfield Ave. South"10/1/83
60Marsilea hirsutaR. Wunderlin et al. 10365USF191296FL: PinellasSt. Petersburg; Fairfield Ave. S and 46th Stree South3/3/87
61Marsilea spC. Clarkson snUSF200757FL: HardeeApprox. 3 mi south of Zolfo Springs7/3/89
62Marsilea vestitano collectorUSF201283FL: Highlands"Seabring; Billy Bowlegs Creek, Highlands Hammock State Park"1/1/71
63Marsilea muticaD. Damrel 2429ASU234980AZ: Maricopa"Arizona State University, Desert Arboretum Park"8/2/99
64Marsilea hirsutaL. Makings 2090ASU260430AZ: MaricopaScottsdale; backyard lily pond6/5/05
65Marsilea mollisG. & M. Hatschbach 54145ASU203441Brazil: MG"Rio Sao Francisco, mun. Buritizeiro"6/9/90
66Marsilea vestitaR. Felger 85-484ASU267754MX: SonoraSan Jose de Guaymas3/6/85
67Marsilea deflexaSteinman et al. 93-373ASU194802MX: Sonora"Laguna Barochipa on the coast of the Gulf of California, ca. 3.3 km sse of Cmahuiroa."11/23/93
68Marsilea vestitaJ. Rebman & H. Lopez 2608ASU203225MX: Baja California"Rancho Las Chichihuas; between Ensendada and Rosarito along Mex. Rt. 1, south of La Mision."4/15/94
69Marsilea vestitaS. Friedman & K. Johnson 456-94ASU206907MX: Sonora"0.8 km n of Diez de Abril at Arroyo Muerto and Powerline road, 5.25 km n of Melchor Ocampo"10/20/94
70Marsilea mollisG. Ferguson 118ASU116486MX: Chihuahua"Laguna Arareco, 7.5 km by road SE Creel on rd. to Cusarare"8/29/81
71Marsilea mexicanaJ. Hernandez snASU215353MX: Zacatecas2 km n of Valparaiso12/24/84
72Marsilea fourneieriJ. Rebman 1684ASU207533MX: Baja California SurRio Commundu; 64 km n of Ciudad Insurgentes and 13.7 miles east of Rancisco Villa4/18/93
73Marsilea vestitaE. Wise 1716ASU146549`CA: San Luis ObisboSanta Margarita Lake6/30/83
74Marsilea vestitaR. Worthington 21894ASU257286NM: Luna"West edge of West Potrillo Mts. At edge of mts., 12 mi E of Columbus in playa roadside ditch"4/17/93
75Marsilea vestitaD. Keil 18024ASU135889CA: San Luis Obisbo"Just S of Creston, W of O'Donovan Road, on fringes of small reservoir."10/23/83
76Marsilea vestitaL. McGill 7203ASU262038AZ: CochiseWillcox; flood drainage channel across N 3rd Ave. between Stewardt St. and Historic Willcox Cemetary.11/9/00
77Marsilea mollisW. T. Johnson snASU133244AZ: Coconino"Baker Lake, Mogollon Rim, jct. state hwy 87 and Forest Road 218A"6/29/84
78Marsilea vestitaG. Marrs-Smith 1211ASU135685AZ: Cochise"San Bernardino Ranch, 18 mi E of Douglas, north part of Black Draw."9/21/81
79Marsilea mollisD. Damrel 627-AASU241765AZ: Gila"Sierra Ancha Mts, off FSRD 682 and 486 intersection, at Indian Camp Tank."9/20/02
80Marsilea mollisT. Wright & M. Baker 93-102ASU202936AZ: Yaupai"NW of Prescott, 1.6 km NW of Pinetop Mtn, 1.2 km SE of Hunt Tank"6/18/93
81Marsilea mollisJ. Collins snASU124092AZ: Cochise"San Rafael, Rafael Valley"9/23/82
82Marsilea mollisE. Lehto 24541ASU111936AZ: Coconino"Foxborough Lake, Schnebly Mill road."6/26/80
83Marsilea mollisM. Baker 8595ASU116549AZ: Coconino"Twenty-Nine Mile Lake, ca. 5 miles due northo f Pine"8/16/91
84Marsilea mollisL. McGill 6860ASU210327AZ:Cochise"Turkey Creek Ranch, est drainage from Chiricuahua Mts into Sulphur Spring Valley; 1/4 mi N of Hwy 181 E at milemarker 49.5"10/1/96
85Marsilea mollisM. Windham 0114DASU113526AZ: Coconino"Coconino National Forest, sw shore of Foxboro Lake 3.29 km ENE of Schnebly Hill Vista and 1.72 km WSW of Mason Tank."10/20/79
86Marsilea mollisPinkava snASU216827AZ:CoconinoFoxboro Lake5/4/96
87Marsilea vestitaR.D. Thomas 114754VPI82735LA: CaldwellAlong west bank of Oachita River at Columbia Recreation area west of US 165 at Columbia11/21/89
88Marsilea muticaM. Robinette snVPI100854VA: PatrickPersistent weed in pond in vicinity of Critz5/25/05
89Marsilea vestitaC.R. Bjork 6868ID122740ID: Nez Perce"Clearwater River, 0.5 km east of the mouth of Catholic Creek."9/23/02
90Marsilea vestitaC.R. Bjork s.n.ID122926ID: Nez PerceCa. 2 miles east of Spalding along Clearwater River; Shallow seasonal pools below Hwy 12.10/1/99
91Marsilea vestitaA. Tiehm 15267ID139382NV: Washoe"Virginia Mts., NW side of Spanish Flat Reservoir at end of Dry Valley Creek."7/18/06
92Marsilea vestitaC.R. Bjork 2404ID134760OR: MalheurSnake River Plains Bioregion; Interstate 84 crossing of the Snake River.8/1/96
93Marsilea oligosporaC.R. Bjork 3916ID124971ID: Owyhee"Duck Valley Indian Reservation; about 11 mi. S of Riddle, creek along Hwy 51."8/1/98
94Marsilea oligosporaF.D. Johnson snID80216ID: Idaho"Swartz Bar, lower Salmon River about 10 mi. NW of Whitebird."8/9/80
95Marsilea polycarpaS.R. Hall & L. Phillipe 28868MO5161408Dominica: St. Andrews"East end of Melville Hall airport, cow pasture near dump area at coast"2/23/97
96Marsilea vestitaN. & P. HolmgrenUTC241370NV:Elko"Deep Creek Reservoir, along the IL Ranch Road, 10.5 km west of the main NS road."7/14/02
97Marsila vestitaA. Tiehm 14569UTC244995NV: Elko"Owyhee Desert, Josephine Reservoir, 2.4 road miles NW ot Butte Springs."6/26/04
98Marsilea vestitaR.J. Shaw 3708UTC187738UT: MillardNorth of Flowell.9/9/84
99Marsilea vestitaWeber & Wittmann 18558UTC212240CO: Baca"Big Hole Canyon, above Est fort Carrizo Creek, Road H"5/22/93
100Marsilea vestitaR.J. & M. Shaw 4986UTC208944MT: Lake"Ninepipes Reservoir Wildlife Refuge, near Charlo; 150 yards above dam."9/11/91
101Marsilea minutaA.R. Diamond 14269MISS70573AL: Pike"Conecuh River, US Hwy 29, east side of river, north of the road."11/16/03
102Marsila minutaD.M. Johnson 800MICHTrinidad: Nariva Cocal"Nariva Cocal, 5 km S of point where Manzanilla-Mayaro Road reaches Manzanilla Bay."3/18/82
103Marsilea deflexaD.M. Johnson 794MICHVenezuela: Guarico"Km 239 on highway from San Fernando de Apure to Calabozo, ca. 36 km N of Camaguan."3/13/82
104Marsilea ancylopodaD.M. Johnson 773MICHArgentina: Corrientes"Depto. Mburucuya, Estancia Sanda Maria"2/12/82
105Marsilea ancylopodaE. Lott & A. Sanders 3987MICHMexico: Jalisco: Quemaro"Mpio. La Huerta; Quemaro, ca. 25 km nw of Esatcion de Biologia Chamela; pond on road to Las Alamandas."11/2/91
106Marsilea minutaM. Dyer 173MICHNigeria: Kano: Acha LafiaAcha Lafia.2/2/80
107Marsilea polycarpaW. WagnerMICHPuerto Rico: Loiza"Loiza, Pinones Munic., grazed island in white and black mangroves."9/23/82
108Marsilea polycarpaD.M. Johnson 793MICHVenezuela: Apure"Pond along road from Mantecal to Elorza, ca. 25 km N of Elorza."3/12/82
109Marsilea mollisN. Murray & D.M. Johnson 1404MICHMexico: ChiapasKm 152 on S side of Hwy 190 just W of San Francisco between Laguna Larga and Ajasaxh.6/3/83
110Marsilea vestitaB. Erttter et al. 8131MICHCA: Contra Costa"Alkali sink W and adjacent to Clifton Court Forebay, ca. 15 air miles SW of Stockton."4/5/89
111Marsilea macropodaD.M. Johnson 721MICHTX: AransasAlong Farm Road 1781 just north of Aransas Co. airport5/23/81
112Marsilea coromandelinaM. Dyer 172MICHNigeria: Kano: Acha LafiaAcha Lafia2/2/80
116Marsilea muticaPage s.n.VPIVA: Hanover